Review



bio rad iq sybr green supermix  (Bio-Rad)


Bioz Verified Symbol Bio-Rad is a verified supplier
Bioz Manufacturer Symbol Bio-Rad manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 98

    Structured Review

    Bio-Rad bio rad iq sybr green supermix
    Bio Rad Iq Sybr Green Supermix, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 98/100, based on 18268 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/iq+sybr+green+supermix+bio+rad/iQ+SYBR+Green+Supermix/pm42121932-93-18-18
    Average 98 stars, based on 18268 article reviews
    bio rad iq sybr green supermix - by Bioz Stars, 2026-09
    98/100 stars

    Images

    Related Articles

    Reverse Transcription:

    Article Title: Bmp9 regulates Notch signaling and the temporal dynamics of angiogenesis via Lunatic Fringe.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Fetal Bovine Serum (FBS) Gibco Cat# 10270-106 DMEM, High Glucose Gibco Cat# 11965092 Trypsin-EDTA (0.05%), phenol red Gibco Cat# 25300062 Penicillin-Streptomycin Gibco Cat# 22571038 PBS (10X), pH 7.4 Gibco Cat# 70011051 iScript Reverse Transcription Supermix Bio Rad Cat# 1708840 iQ SYBR Green Supermix Bio Rad Cat# 1708880 BJ Fibroblasts ATCC Cat# CRL-2522 HEK-293 Cells ATCC Cat# CRL-1573 HUVECs Promocell Cat# C-12203 EGM-2 Endothelial Cell Growth Medium-2 BulletKit Lonza Cat# CC-3162 Endothelial Cell Basal Medium 2 Promocell Cat# C-22211 Pericyte Growth Medium 2 Promocell Cat# C-28041 Human Pericytes Promocell Cat# C-12980 FluoroshieldTM with DAPI Sigma-Aldrich Cat# F6057 Paraformaldehyde 16% Electron Microscopy Sciences Cat# 15710 Trypan Blue Solution, 0.4% Gibco Cat# 15250061 Fugene HD Promega Cat# E2311 Cycloheximide, 95% Sigma-Aldrich Cat# 01810 qRT-PCR Primers and siRNA Hs_HEY1_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_HES1_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_LFNG_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_RFNG_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_MFNG_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_ACTB_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_ACVRL1_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_PDGFRB_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_CDH5_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_PECAM1_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Mm_Hes1_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Mm_Hey1_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Mm_Lfng_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Mm_Actb_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_LFNG_10 FlexiTube siRNA Qiagen Cat# 1027417 Hs_ACVRL1_5 FlexiTube siRNA Qiagen Cat# 1027417 Hs_JAG1_5 FlexiTube siRNA Qiagen Cat# 1027417 Hs_DLL4_5 FlexiTube siRNA Qiagen Cat# 1027417 AllStars Negative Control siRNA Qiagen Cat# 1027280 Control morpholino oligonucleotide: 5’- CCTCTTACCTCAGTTACAATTTATA -3’ Gene Tools Cat# 2934999000 lfng morpholino oligonucleotide: 5’- ACCGTGTATACCTGTCGCATGTTTC -3’ Gene Tools ID# ZDB-MRPHLNO-100510-10 Plasmids pReceiver-Lv205-hLFNG Genecopoeia Cat# EX-H1563-LV205-GS pReceiver-LV205 Genecopoeia Cat# EX-Neg-LV205 pLV-mCherry Addgene Cat# 36084; RRID: Addgene_36084 pRSV-Rev Addgene Cat# 12253; RRID: Addgene_12253 pCMV-VSV-G Addgene Cat# 8454; RRID: Addgene_8454 (Continued on next page) Developmental Cell 61, 1–17.e1–e9, April 8, 2026 e2 .. Tamoxifen-inducible Cdh5-CreErt2 and acvrl1 loxP mice were kindly provided by Ralf Adams and S. Paul Oh respectively, and were back-crossed to C57/Bl6 background (Charles River) for 10 generations.

    Article Title: Live-cell single-vRNP imaging identifies viral gene expression signatures that shape influenza infection heterogeneity.
    Article Snippet: Article Live-cell single-vRNP imaging identifies viral gene expression signatures that shape influenza infection heterogeneity

    SYBR Green Assay:

    Article Title: Bmp9 regulates Notch signaling and the temporal dynamics of angiogenesis via Lunatic Fringe.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Fetal Bovine Serum (FBS) Gibco Cat# 10270-106 DMEM, High Glucose Gibco Cat# 11965092 Trypsin-EDTA (0.05%), phenol red Gibco Cat# 25300062 Penicillin-Streptomycin Gibco Cat# 22571038 PBS (10X), pH 7.4 Gibco Cat# 70011051 iScript Reverse Transcription Supermix Bio Rad Cat# 1708840 iQ SYBR Green Supermix Bio Rad Cat# 1708880 BJ Fibroblasts ATCC Cat# CRL-2522 HEK-293 Cells ATCC Cat# CRL-1573 HUVECs Promocell Cat# C-12203 EGM-2 Endothelial Cell Growth Medium-2 BulletKit Lonza Cat# CC-3162 Endothelial Cell Basal Medium 2 Promocell Cat# C-22211 Pericyte Growth Medium 2 Promocell Cat# C-28041 Human Pericytes Promocell Cat# C-12980 FluoroshieldTM with DAPI Sigma-Aldrich Cat# F6057 Paraformaldehyde 16% Electron Microscopy Sciences Cat# 15710 Trypan Blue Solution, 0.4% Gibco Cat# 15250061 Fugene HD Promega Cat# E2311 Cycloheximide, 95% Sigma-Aldrich Cat# 01810 qRT-PCR Primers and siRNA Hs_HEY1_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_HES1_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_LFNG_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_RFNG_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_MFNG_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_ACTB_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_ACVRL1_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_PDGFRB_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_CDH5_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_PECAM1_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Mm_Hes1_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Mm_Hey1_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Mm_Lfng_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Mm_Actb_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_LFNG_10 FlexiTube siRNA Qiagen Cat# 1027417 Hs_ACVRL1_5 FlexiTube siRNA Qiagen Cat# 1027417 Hs_JAG1_5 FlexiTube siRNA Qiagen Cat# 1027417 Hs_DLL4_5 FlexiTube siRNA Qiagen Cat# 1027417 AllStars Negative Control siRNA Qiagen Cat# 1027280 Control morpholino oligonucleotide: 5’- CCTCTTACCTCAGTTACAATTTATA -3’ Gene Tools Cat# 2934999000 lfng morpholino oligonucleotide: 5’- ACCGTGTATACCTGTCGCATGTTTC -3’ Gene Tools ID# ZDB-MRPHLNO-100510-10 Plasmids pReceiver-Lv205-hLFNG Genecopoeia Cat# EX-H1563-LV205-GS pReceiver-LV205 Genecopoeia Cat# EX-Neg-LV205 pLV-mCherry Addgene Cat# 36084; RRID: Addgene_36084 pRSV-Rev Addgene Cat# 12253; RRID: Addgene_12253 pCMV-VSV-G Addgene Cat# 8454; RRID: Addgene_8454 (Continued on next page) Developmental Cell 61, 1–17.e1–e9, April 8, 2026 e2 .. Tamoxifen-inducible Cdh5-CreErt2 and acvrl1 loxP mice were kindly provided by Ralf Adams and S. Paul Oh respectively, and were back-crossed to C57/Bl6 background (Charles River) for 10 generations.

    Article Title: Differences in photosystem II activity and carbon allocation during photomixotrophic growth in distinct wild‐type strains of Synechocystis sp. PCC 6803
    Article Snippet: RNA was isolated using the TRIzol® Reagent (Invitrogen, Carlsbad, CA, USA), treated with TURBO DNA‐freeTM Kit (Invitrogen, Carlsbad, CA, USA), and purified with the chloroform:phenol:isoamyl alcohol method. cDNA was synthesized using the iScript cDNA Synthesis kit (Bio‐Rad, Hercules, CA, USA) with random primers. .. The qPCR reaction was carried out in 10 μL reactions composed of 5 μL of iQ SYBR® Green Supermix (Bio‐Rad), 2 μL dH 2 O, 2 μL diluted cDNA template (15 ng of RNA), and 0.5 μL mix of each 10 μ m forward and reverse PCR primer, utilizing the Bio‐Rad IQ5 system using rrn16Sa as a reference gene. ..

    Article Title: Mating‐Type Loci Modulate Pathogenicity and Non‐Sexual Development Through Autocrine Pheromone Signalling in the Asexual Fungus Fusarium oxysporum
    Article Snippet: Complementary DNA synthesis was carried out using Moloney Murine Leukaemia Virus reverse transcriptase with 1 μg of total RNA and poly‐d(T) antisense primers according to the supplier's protocol (Invitrogen). .. Quantitative PCR was performed using an iQ SYBR Green Supermix (Bio‐Rad) in an iCycler apparatus (Bio‐Rad) with 15 μL reactions containing 7.5 μL SYBR Green Supermix, 400 ng cDNA template, and 300 nM each gene‐specific primer as described previously (Vitale et al. ). ..

    Article Title: Live-cell single-vRNP imaging identifies viral gene expression signatures that shape influenza infection heterogeneity.
    Article Snippet: Article Live-cell single-vRNP imaging identifies viral gene expression signatures that shape influenza infection heterogeneity

    Article Title: Auxin-Dependent Activation of RHD6-RSL4 Cascade Promotes Root Hair Growth Under Boron Deficiency in Arabidopsis Primary Root Apices.
    Article Snippet: Two micrograms of DNase‐treated total RNA were used to prepare cDNA by reverse transcription with M‐MLV reverse transcriptase (New England Biolabs Inc., Ipswich, MA, USA) and oligo (dT)18 primers (Bioline, London, UK), according to the manufacturer's protocol. .. Gene expression was determined by quantitative RT‐PCR (MyiQ real‐time PCR detection system, Bio‐Rad Laboratories Inc., Hercules, CA, USA) using gene‐ specific primers (Supporting Information Table S2) and iQ SYBR Green Supermix (Bio‐Rad), following the manufacturer's instructions. ..

    Article Title: Synergistic Impacts of Co-Exposure to Microplastics and Vibrio harveyi on the Immune and Stress Responses of the Big-Belly Seahorse Hippocampus abdominalis.
    Article Snippet: Microplastics (MPs) originating from synthetic polymers can act as vectors for harmful microorganisms and pollutants, exacerbating ecological risks.. Vibrio harveyi, commonly found in seawater, is a major opportunistic pathogen causing vibriosis in marine fish.. MPs and pathogenic bacteria such as V. harveyi have increasingly been recognized as co‐contaminants in marine environments.

    Article Title: Small molecule-directed differentiation of submerged-cultured human nasal airway epithelia for respiratory disease modeling.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-beta IV Tubulin antibody [EPR16776] Abcam Cat#ab179509; RRID: AB_2716759 Anti-Beta-Tubulin IV [ONS1A6] Emergo Biogenex Cat#MU178-UC; RRID: AB_2335625 MUC5AC Monoclonal Antibody (45M) Thermo Fisher Scientific Cat#MA1-38223; RRID: AB_2266697 Anti-p63 antibody [EPR5701] Abcam Cat#ab124762; RRID: AB_10971840 FOXJ1 Monoclonal Antibody (2A5) Thermo Fisher Scientific Cat#14-9965-80; RRID: AB_1548836 SLPI, Human, pAb Hycult Biotech Cat#HP9024; RRID: AB_2286624 Human pIgR Antibody R&D systems Cat#MAB27171; RRID: AB_3657978 Monoclonal Antibody to CC16 Origene Tech Cat#AM26360PU-N; RRID: AB_11216041 Anti-RSV Antibody, clone 133-1H Merck Cat#MAB8262; RRID: AB_95302 Anti-Rabbit IgG, Alexa Fluor 488 Thermo Fisher Scientific Cat#A-11034; RRID: AB_2576217 Anti-Mouse IgG1, Alexa Fluor 647 Thermo Fisher Scientific Cat#A-21240; RRID: AB_2535809 Chemicals and recombinant proteins DMEM Thermo Fisher Scientific Cat#12634-028 Opti-MEM Thermo Fisher Scientific Cat#31985062 BEpiCM-b Sciencell Cat#3211 advanced DMEM/F-12 Thermo Fisher Scientific Cat#12634-028 B-27 Supplement, serum free Thermo Fisher Scientific Cat#17504001 HEPES Thermo Fisher Scientific Cat#15630080 GlutaMAX Thermo Fisher Scientific Cat#35050-061 Hydrocortisone Sigma-Aldrich Cat#H0888 Epinephrine hydrochloride Sigma-Aldrich Cat#E4642 N-acetyl-L-cysteine Sigma-Aldrich Cat#A9165 Nicotinamide Sigma-Aldrich Cat#N0636 3,3′,5-Triiodo-L-thyronine sodium salt Sigma-Aldrich Cat#T6397 Penicillin/streptomycin Thermo Fisher Scientific Cat#15070-063 Primocin InvivoGen Cat#ant-pm-2 Amphotericin B Thermo Fisher Scientific Cat#15290018 Gentamicin Sigma-Aldrich Cat#G1397 Vancomycin Sigma-Aldrich Cat#SBR00001 A83-01 Tocris Cat#2939/10 Y-27632 Selleck Chemicals Cat#S1049 Rapamycin Sigma-Aldrich Cat#553210 DAPT Thermo Fisher Scientific Cat#15467109 DMH1 Selleck Chemicals Cat#S7146 TTNPB Cayman Cat#16144-1 RSPO3-Fc Fusion Protein CM U-Protein Express Cat#R001 Recombinant human Heregulin-β1 PeproTech Cat#100-03 Recombinant human FGF10 PeproTech Cat#100-26 Recombinant human HGF PeproTech Cat#100-39H Recombinant human EGF PeproTech Cat#AF-100-15 Recombinant human FGF7 PeproTech Cat#100-19 Recombinant Interleukin-1β PeproTech Cat#200-01 Nirsevimab Provided by AstraZeneca N/A (Continued on next page) e1 Cell Reports Medicine 7, 102692, April 21, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER Collagen IV Sigma-Aldrich Cat#C7521 PureCol Advanced BioMatrix Cat#5005 Cultrex Basement Membrane Extract, Type 2 Trevigen Cat#3532-010 TrypLE express enzyme Thermo Fisher Scientific Cat#12605010 CryoStor CS10 STEMCELL Technologies Cat#07930 SiR-tubulin Spirochrome AG Cat#SC002 DAPI Sigma-Aldrich Cat#D9542 ProLong Gold Thermo Fisher Scientific Cat#P36934 VX-809 Selleck Chemicals Cat#S1565 VX-661 Selleck Chemicals Cat#S7059 VX-445 MedChemExpress Cat#HY-11177 VX-770 Selleck Chemicals Cat#S1144 Calcein green (AM) Invitrogen Cat #C34852 Forskolin Sigma-Aldrich Cat#F3917 G418 (Geneticin) Invivogen Cat#GNL-40-03 ELX-02 (Exaluren) MedChemExpress Cat#HY-114231 Cultureware 96-well culture plates Greiner Bio-One Cat# 655182 24-well culture plates Greiner Bio-One Cat# 662160 12-well culture plates Greiner Bio-One Cat#665165 6-well culture plates Greiner Bio-One Cat#657160 6.5 mm Transwell with 0.4 μm Pore Polyester Membrane Insert Corning Cat#3470 Nunc dishes (35 mm) with UpCell Surface Thermo Fisher Scientific Cat#174904 Commercial kits RNeasy Mini Kit Qiagen Cat#74104 iScript cDNA synthesis kit Bio-Rad Cat#1708891 iQ SYBR Green Supermix Bio-Rad Cat1708880 Oligonucleotides qPCR Primers This papers, Table S4 N/A Experimental models: Primary cells and cell lines Human Nasal Epithelial Cells (HNEC) UMC Utrecht Protocol ID: 16–586, and 21-044 Human Epithelioma-2 (HEp-2) ATCC Cat#CCL-23 Experimental models: viral strains mKate-RSV-A2 Hotard et al.37 N/A RSV-A and -B clinical isolate strains Langedijk et al.38 N/A Equipment Thunder Imager 3D live Cell with Leica N/A Leica DFC9000 GCT camera Leica N/A Zeiss LSM800 confocal microscope Zeiss N/A Nanodrop spectrophotometer Thermo Fisher N/A CFX96 real-time detection machine Bio-Rad N/A BD FACSJazz BD Bioscience N/A Software and algorithms Leica LAS X Software Leica https://www.leicamicrosystems.com/ Zen Blue Software Zeiss https://www.zeiss.com/ ImageJ/FIJI NIH, Fiji developers https://imagej.net/Fiji/ GNU Image Manipulation Program https://www.gimp.org/ (Continued on next page) Cell Reports Medicine 7, 102692, April 21, 2026 e2 ..

    Article Title: ChIP ‐ MS in Plant Systems: Mapping the H3K27ac Proteome During the Greening Process
    Article Snippet: Extracted RNA was treated with DNase I (Thermo Scientific). .. Complementary DNA (cDNA) was synthesized using iScript cDNA Synthesis Kit (Bio‐Rad) following the manufacturer's instructions. qPCR reactions were performed using iQ SYBR Green Supermix (Bio‐Rad) on CFX96 or 384 Real‐Time System (Bio‐Rad). ..

    Electron Microscopy:

    Article Title: Bmp9 regulates Notch signaling and the temporal dynamics of angiogenesis via Lunatic Fringe.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Fetal Bovine Serum (FBS) Gibco Cat# 10270-106 DMEM, High Glucose Gibco Cat# 11965092 Trypsin-EDTA (0.05%), phenol red Gibco Cat# 25300062 Penicillin-Streptomycin Gibco Cat# 22571038 PBS (10X), pH 7.4 Gibco Cat# 70011051 iScript Reverse Transcription Supermix Bio Rad Cat# 1708840 iQ SYBR Green Supermix Bio Rad Cat# 1708880 BJ Fibroblasts ATCC Cat# CRL-2522 HEK-293 Cells ATCC Cat# CRL-1573 HUVECs Promocell Cat# C-12203 EGM-2 Endothelial Cell Growth Medium-2 BulletKit Lonza Cat# CC-3162 Endothelial Cell Basal Medium 2 Promocell Cat# C-22211 Pericyte Growth Medium 2 Promocell Cat# C-28041 Human Pericytes Promocell Cat# C-12980 FluoroshieldTM with DAPI Sigma-Aldrich Cat# F6057 Paraformaldehyde 16% Electron Microscopy Sciences Cat# 15710 Trypan Blue Solution, 0.4% Gibco Cat# 15250061 Fugene HD Promega Cat# E2311 Cycloheximide, 95% Sigma-Aldrich Cat# 01810 qRT-PCR Primers and siRNA Hs_HEY1_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_HES1_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_LFNG_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_RFNG_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_MFNG_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_ACTB_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_ACVRL1_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_PDGFRB_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_CDH5_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_PECAM1_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Mm_Hes1_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Mm_Hey1_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Mm_Lfng_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Mm_Actb_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_LFNG_10 FlexiTube siRNA Qiagen Cat# 1027417 Hs_ACVRL1_5 FlexiTube siRNA Qiagen Cat# 1027417 Hs_JAG1_5 FlexiTube siRNA Qiagen Cat# 1027417 Hs_DLL4_5 FlexiTube siRNA Qiagen Cat# 1027417 AllStars Negative Control siRNA Qiagen Cat# 1027280 Control morpholino oligonucleotide: 5’- CCTCTTACCTCAGTTACAATTTATA -3’ Gene Tools Cat# 2934999000 lfng morpholino oligonucleotide: 5’- ACCGTGTATACCTGTCGCATGTTTC -3’ Gene Tools ID# ZDB-MRPHLNO-100510-10 Plasmids pReceiver-Lv205-hLFNG Genecopoeia Cat# EX-H1563-LV205-GS pReceiver-LV205 Genecopoeia Cat# EX-Neg-LV205 pLV-mCherry Addgene Cat# 36084; RRID: Addgene_36084 pRSV-Rev Addgene Cat# 12253; RRID: Addgene_12253 pCMV-VSV-G Addgene Cat# 8454; RRID: Addgene_8454 (Continued on next page) Developmental Cell 61, 1–17.e1–e9, April 8, 2026 e2 .. Tamoxifen-inducible Cdh5-CreErt2 and acvrl1 loxP mice were kindly provided by Ralf Adams and S. Paul Oh respectively, and were back-crossed to C57/Bl6 background (Charles River) for 10 generations.

    Quantitative RT-PCR:

    Article Title: Bmp9 regulates Notch signaling and the temporal dynamics of angiogenesis via Lunatic Fringe.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Fetal Bovine Serum (FBS) Gibco Cat# 10270-106 DMEM, High Glucose Gibco Cat# 11965092 Trypsin-EDTA (0.05%), phenol red Gibco Cat# 25300062 Penicillin-Streptomycin Gibco Cat# 22571038 PBS (10X), pH 7.4 Gibco Cat# 70011051 iScript Reverse Transcription Supermix Bio Rad Cat# 1708840 iQ SYBR Green Supermix Bio Rad Cat# 1708880 BJ Fibroblasts ATCC Cat# CRL-2522 HEK-293 Cells ATCC Cat# CRL-1573 HUVECs Promocell Cat# C-12203 EGM-2 Endothelial Cell Growth Medium-2 BulletKit Lonza Cat# CC-3162 Endothelial Cell Basal Medium 2 Promocell Cat# C-22211 Pericyte Growth Medium 2 Promocell Cat# C-28041 Human Pericytes Promocell Cat# C-12980 FluoroshieldTM with DAPI Sigma-Aldrich Cat# F6057 Paraformaldehyde 16% Electron Microscopy Sciences Cat# 15710 Trypan Blue Solution, 0.4% Gibco Cat# 15250061 Fugene HD Promega Cat# E2311 Cycloheximide, 95% Sigma-Aldrich Cat# 01810 qRT-PCR Primers and siRNA Hs_HEY1_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_HES1_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_LFNG_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_RFNG_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_MFNG_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_ACTB_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_ACVRL1_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_PDGFRB_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_CDH5_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_PECAM1_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Mm_Hes1_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Mm_Hey1_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Mm_Lfng_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Mm_Actb_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_LFNG_10 FlexiTube siRNA Qiagen Cat# 1027417 Hs_ACVRL1_5 FlexiTube siRNA Qiagen Cat# 1027417 Hs_JAG1_5 FlexiTube siRNA Qiagen Cat# 1027417 Hs_DLL4_5 FlexiTube siRNA Qiagen Cat# 1027417 AllStars Negative Control siRNA Qiagen Cat# 1027280 Control morpholino oligonucleotide: 5’- CCTCTTACCTCAGTTACAATTTATA -3’ Gene Tools Cat# 2934999000 lfng morpholino oligonucleotide: 5’- ACCGTGTATACCTGTCGCATGTTTC -3’ Gene Tools ID# ZDB-MRPHLNO-100510-10 Plasmids pReceiver-Lv205-hLFNG Genecopoeia Cat# EX-H1563-LV205-GS pReceiver-LV205 Genecopoeia Cat# EX-Neg-LV205 pLV-mCherry Addgene Cat# 36084; RRID: Addgene_36084 pRSV-Rev Addgene Cat# 12253; RRID: Addgene_12253 pCMV-VSV-G Addgene Cat# 8454; RRID: Addgene_8454 (Continued on next page) Developmental Cell 61, 1–17.e1–e9, April 8, 2026 e2 .. Tamoxifen-inducible Cdh5-CreErt2 and acvrl1 loxP mice were kindly provided by Ralf Adams and S. Paul Oh respectively, and were back-crossed to C57/Bl6 background (Charles River) for 10 generations.

    Article Title: Auxin-Dependent Activation of RHD6-RSL4 Cascade Promotes Root Hair Growth Under Boron Deficiency in Arabidopsis Primary Root Apices.
    Article Snippet: Two micrograms of DNase‐treated total RNA were used to prepare cDNA by reverse transcription with M‐MLV reverse transcriptase (New England Biolabs Inc., Ipswich, MA, USA) and oligo (dT)18 primers (Bioline, London, UK), according to the manufacturer's protocol. .. Gene expression was determined by quantitative RT‐PCR (MyiQ real‐time PCR detection system, Bio‐Rad Laboratories Inc., Hercules, CA, USA) using gene‐ specific primers (Supporting Information Table S2) and iQ SYBR Green Supermix (Bio‐Rad), following the manufacturer's instructions. ..

    Negative Control:

    Article Title: Bmp9 regulates Notch signaling and the temporal dynamics of angiogenesis via Lunatic Fringe.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Fetal Bovine Serum (FBS) Gibco Cat# 10270-106 DMEM, High Glucose Gibco Cat# 11965092 Trypsin-EDTA (0.05%), phenol red Gibco Cat# 25300062 Penicillin-Streptomycin Gibco Cat# 22571038 PBS (10X), pH 7.4 Gibco Cat# 70011051 iScript Reverse Transcription Supermix Bio Rad Cat# 1708840 iQ SYBR Green Supermix Bio Rad Cat# 1708880 BJ Fibroblasts ATCC Cat# CRL-2522 HEK-293 Cells ATCC Cat# CRL-1573 HUVECs Promocell Cat# C-12203 EGM-2 Endothelial Cell Growth Medium-2 BulletKit Lonza Cat# CC-3162 Endothelial Cell Basal Medium 2 Promocell Cat# C-22211 Pericyte Growth Medium 2 Promocell Cat# C-28041 Human Pericytes Promocell Cat# C-12980 FluoroshieldTM with DAPI Sigma-Aldrich Cat# F6057 Paraformaldehyde 16% Electron Microscopy Sciences Cat# 15710 Trypan Blue Solution, 0.4% Gibco Cat# 15250061 Fugene HD Promega Cat# E2311 Cycloheximide, 95% Sigma-Aldrich Cat# 01810 qRT-PCR Primers and siRNA Hs_HEY1_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_HES1_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_LFNG_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_RFNG_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_MFNG_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_ACTB_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_ACVRL1_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_PDGFRB_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_CDH5_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_PECAM1_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Mm_Hes1_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Mm_Hey1_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Mm_Lfng_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Mm_Actb_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_LFNG_10 FlexiTube siRNA Qiagen Cat# 1027417 Hs_ACVRL1_5 FlexiTube siRNA Qiagen Cat# 1027417 Hs_JAG1_5 FlexiTube siRNA Qiagen Cat# 1027417 Hs_DLL4_5 FlexiTube siRNA Qiagen Cat# 1027417 AllStars Negative Control siRNA Qiagen Cat# 1027280 Control morpholino oligonucleotide: 5’- CCTCTTACCTCAGTTACAATTTATA -3’ Gene Tools Cat# 2934999000 lfng morpholino oligonucleotide: 5’- ACCGTGTATACCTGTCGCATGTTTC -3’ Gene Tools ID# ZDB-MRPHLNO-100510-10 Plasmids pReceiver-Lv205-hLFNG Genecopoeia Cat# EX-H1563-LV205-GS pReceiver-LV205 Genecopoeia Cat# EX-Neg-LV205 pLV-mCherry Addgene Cat# 36084; RRID: Addgene_36084 pRSV-Rev Addgene Cat# 12253; RRID: Addgene_12253 pCMV-VSV-G Addgene Cat# 8454; RRID: Addgene_8454 (Continued on next page) Developmental Cell 61, 1–17.e1–e9, April 8, 2026 e2 .. Tamoxifen-inducible Cdh5-CreErt2 and acvrl1 loxP mice were kindly provided by Ralf Adams and S. Paul Oh respectively, and were back-crossed to C57/Bl6 background (Charles River) for 10 generations.

    Control:

    Article Title: Bmp9 regulates Notch signaling and the temporal dynamics of angiogenesis via Lunatic Fringe.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Fetal Bovine Serum (FBS) Gibco Cat# 10270-106 DMEM, High Glucose Gibco Cat# 11965092 Trypsin-EDTA (0.05%), phenol red Gibco Cat# 25300062 Penicillin-Streptomycin Gibco Cat# 22571038 PBS (10X), pH 7.4 Gibco Cat# 70011051 iScript Reverse Transcription Supermix Bio Rad Cat# 1708840 iQ SYBR Green Supermix Bio Rad Cat# 1708880 BJ Fibroblasts ATCC Cat# CRL-2522 HEK-293 Cells ATCC Cat# CRL-1573 HUVECs Promocell Cat# C-12203 EGM-2 Endothelial Cell Growth Medium-2 BulletKit Lonza Cat# CC-3162 Endothelial Cell Basal Medium 2 Promocell Cat# C-22211 Pericyte Growth Medium 2 Promocell Cat# C-28041 Human Pericytes Promocell Cat# C-12980 FluoroshieldTM with DAPI Sigma-Aldrich Cat# F6057 Paraformaldehyde 16% Electron Microscopy Sciences Cat# 15710 Trypan Blue Solution, 0.4% Gibco Cat# 15250061 Fugene HD Promega Cat# E2311 Cycloheximide, 95% Sigma-Aldrich Cat# 01810 qRT-PCR Primers and siRNA Hs_HEY1_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_HES1_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_LFNG_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_RFNG_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_MFNG_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_ACTB_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_ACVRL1_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_PDGFRB_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_CDH5_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_PECAM1_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Mm_Hes1_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Mm_Hey1_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Mm_Lfng_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Mm_Actb_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_LFNG_10 FlexiTube siRNA Qiagen Cat# 1027417 Hs_ACVRL1_5 FlexiTube siRNA Qiagen Cat# 1027417 Hs_JAG1_5 FlexiTube siRNA Qiagen Cat# 1027417 Hs_DLL4_5 FlexiTube siRNA Qiagen Cat# 1027417 AllStars Negative Control siRNA Qiagen Cat# 1027280 Control morpholino oligonucleotide: 5’- CCTCTTACCTCAGTTACAATTTATA -3’ Gene Tools Cat# 2934999000 lfng morpholino oligonucleotide: 5’- ACCGTGTATACCTGTCGCATGTTTC -3’ Gene Tools ID# ZDB-MRPHLNO-100510-10 Plasmids pReceiver-Lv205-hLFNG Genecopoeia Cat# EX-H1563-LV205-GS pReceiver-LV205 Genecopoeia Cat# EX-Neg-LV205 pLV-mCherry Addgene Cat# 36084; RRID: Addgene_36084 pRSV-Rev Addgene Cat# 12253; RRID: Addgene_12253 pCMV-VSV-G Addgene Cat# 8454; RRID: Addgene_8454 (Continued on next page) Developmental Cell 61, 1–17.e1–e9, April 8, 2026 e2 .. Tamoxifen-inducible Cdh5-CreErt2 and acvrl1 loxP mice were kindly provided by Ralf Adams and S. Paul Oh respectively, and were back-crossed to C57/Bl6 background (Charles River) for 10 generations.

    Real-time Polymerase Chain Reaction:

    Article Title: Differences in photosystem II activity and carbon allocation during photomixotrophic growth in distinct wild‐type strains of Synechocystis sp. PCC 6803
    Article Snippet: RNA was isolated using the TRIzol® Reagent (Invitrogen, Carlsbad, CA, USA), treated with TURBO DNA‐freeTM Kit (Invitrogen, Carlsbad, CA, USA), and purified with the chloroform:phenol:isoamyl alcohol method. cDNA was synthesized using the iScript cDNA Synthesis kit (Bio‐Rad, Hercules, CA, USA) with random primers. .. The qPCR reaction was carried out in 10 μL reactions composed of 5 μL of iQ SYBR® Green Supermix (Bio‐Rad), 2 μL dH 2 O, 2 μL diluted cDNA template (15 ng of RNA), and 0.5 μL mix of each 10 μ m forward and reverse PCR primer, utilizing the Bio‐Rad IQ5 system using rrn16Sa as a reference gene. ..

    Article Title: Mating‐Type Loci Modulate Pathogenicity and Non‐Sexual Development Through Autocrine Pheromone Signalling in the Asexual Fungus Fusarium oxysporum
    Article Snippet: Complementary DNA synthesis was carried out using Moloney Murine Leukaemia Virus reverse transcriptase with 1 μg of total RNA and poly‐d(T) antisense primers according to the supplier's protocol (Invitrogen). .. Quantitative PCR was performed using an iQ SYBR Green Supermix (Bio‐Rad) in an iCycler apparatus (Bio‐Rad) with 15 μL reactions containing 7.5 μL SYBR Green Supermix, 400 ng cDNA template, and 300 nM each gene‐specific primer as described previously (Vitale et al. ). ..

    Article Title: Auxin-Dependent Activation of RHD6-RSL4 Cascade Promotes Root Hair Growth Under Boron Deficiency in Arabidopsis Primary Root Apices.
    Article Snippet: Two micrograms of DNase‐treated total RNA were used to prepare cDNA by reverse transcription with M‐MLV reverse transcriptase (New England Biolabs Inc., Ipswich, MA, USA) and oligo (dT)18 primers (Bioline, London, UK), according to the manufacturer's protocol. .. Gene expression was determined by quantitative RT‐PCR (MyiQ real‐time PCR detection system, Bio‐Rad Laboratories Inc., Hercules, CA, USA) using gene‐ specific primers (Supporting Information Table S2) and iQ SYBR Green Supermix (Bio‐Rad), following the manufacturer's instructions. ..

    Article Title: Synergistic Impacts of Co-Exposure to Microplastics and Vibrio harveyi on the Immune and Stress Responses of the Big-Belly Seahorse Hippocampus abdominalis.
    Article Snippet: Microplastics (MPs) originating from synthetic polymers can act as vectors for harmful microorganisms and pollutants, exacerbating ecological risks.. Vibrio harveyi, commonly found in seawater, is a major opportunistic pathogen causing vibriosis in marine fish.. MPs and pathogenic bacteria such as V. harveyi have increasingly been recognized as co‐contaminants in marine environments.

    Article Title: Small molecule-directed differentiation of submerged-cultured human nasal airway epithelia for respiratory disease modeling.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-beta IV Tubulin antibody [EPR16776] Abcam Cat#ab179509; RRID: AB_2716759 Anti-Beta-Tubulin IV [ONS1A6] Emergo Biogenex Cat#MU178-UC; RRID: AB_2335625 MUC5AC Monoclonal Antibody (45M) Thermo Fisher Scientific Cat#MA1-38223; RRID: AB_2266697 Anti-p63 antibody [EPR5701] Abcam Cat#ab124762; RRID: AB_10971840 FOXJ1 Monoclonal Antibody (2A5) Thermo Fisher Scientific Cat#14-9965-80; RRID: AB_1548836 SLPI, Human, pAb Hycult Biotech Cat#HP9024; RRID: AB_2286624 Human pIgR Antibody R&D systems Cat#MAB27171; RRID: AB_3657978 Monoclonal Antibody to CC16 Origene Tech Cat#AM26360PU-N; RRID: AB_11216041 Anti-RSV Antibody, clone 133-1H Merck Cat#MAB8262; RRID: AB_95302 Anti-Rabbit IgG, Alexa Fluor 488 Thermo Fisher Scientific Cat#A-11034; RRID: AB_2576217 Anti-Mouse IgG1, Alexa Fluor 647 Thermo Fisher Scientific Cat#A-21240; RRID: AB_2535809 Chemicals and recombinant proteins DMEM Thermo Fisher Scientific Cat#12634-028 Opti-MEM Thermo Fisher Scientific Cat#31985062 BEpiCM-b Sciencell Cat#3211 advanced DMEM/F-12 Thermo Fisher Scientific Cat#12634-028 B-27 Supplement, serum free Thermo Fisher Scientific Cat#17504001 HEPES Thermo Fisher Scientific Cat#15630080 GlutaMAX Thermo Fisher Scientific Cat#35050-061 Hydrocortisone Sigma-Aldrich Cat#H0888 Epinephrine hydrochloride Sigma-Aldrich Cat#E4642 N-acetyl-L-cysteine Sigma-Aldrich Cat#A9165 Nicotinamide Sigma-Aldrich Cat#N0636 3,3′,5-Triiodo-L-thyronine sodium salt Sigma-Aldrich Cat#T6397 Penicillin/streptomycin Thermo Fisher Scientific Cat#15070-063 Primocin InvivoGen Cat#ant-pm-2 Amphotericin B Thermo Fisher Scientific Cat#15290018 Gentamicin Sigma-Aldrich Cat#G1397 Vancomycin Sigma-Aldrich Cat#SBR00001 A83-01 Tocris Cat#2939/10 Y-27632 Selleck Chemicals Cat#S1049 Rapamycin Sigma-Aldrich Cat#553210 DAPT Thermo Fisher Scientific Cat#15467109 DMH1 Selleck Chemicals Cat#S7146 TTNPB Cayman Cat#16144-1 RSPO3-Fc Fusion Protein CM U-Protein Express Cat#R001 Recombinant human Heregulin-β1 PeproTech Cat#100-03 Recombinant human FGF10 PeproTech Cat#100-26 Recombinant human HGF PeproTech Cat#100-39H Recombinant human EGF PeproTech Cat#AF-100-15 Recombinant human FGF7 PeproTech Cat#100-19 Recombinant Interleukin-1β PeproTech Cat#200-01 Nirsevimab Provided by AstraZeneca N/A (Continued on next page) e1 Cell Reports Medicine 7, 102692, April 21, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER Collagen IV Sigma-Aldrich Cat#C7521 PureCol Advanced BioMatrix Cat#5005 Cultrex Basement Membrane Extract, Type 2 Trevigen Cat#3532-010 TrypLE express enzyme Thermo Fisher Scientific Cat#12605010 CryoStor CS10 STEMCELL Technologies Cat#07930 SiR-tubulin Spirochrome AG Cat#SC002 DAPI Sigma-Aldrich Cat#D9542 ProLong Gold Thermo Fisher Scientific Cat#P36934 VX-809 Selleck Chemicals Cat#S1565 VX-661 Selleck Chemicals Cat#S7059 VX-445 MedChemExpress Cat#HY-11177 VX-770 Selleck Chemicals Cat#S1144 Calcein green (AM) Invitrogen Cat #C34852 Forskolin Sigma-Aldrich Cat#F3917 G418 (Geneticin) Invivogen Cat#GNL-40-03 ELX-02 (Exaluren) MedChemExpress Cat#HY-114231 Cultureware 96-well culture plates Greiner Bio-One Cat# 655182 24-well culture plates Greiner Bio-One Cat# 662160 12-well culture plates Greiner Bio-One Cat#665165 6-well culture plates Greiner Bio-One Cat#657160 6.5 mm Transwell with 0.4 μm Pore Polyester Membrane Insert Corning Cat#3470 Nunc dishes (35 mm) with UpCell Surface Thermo Fisher Scientific Cat#174904 Commercial kits RNeasy Mini Kit Qiagen Cat#74104 iScript cDNA synthesis kit Bio-Rad Cat#1708891 iQ SYBR Green Supermix Bio-Rad Cat1708880 Oligonucleotides qPCR Primers This papers, Table S4 N/A Experimental models: Primary cells and cell lines Human Nasal Epithelial Cells (HNEC) UMC Utrecht Protocol ID: 16–586, and 21-044 Human Epithelioma-2 (HEp-2) ATCC Cat#CCL-23 Experimental models: viral strains mKate-RSV-A2 Hotard et al.37 N/A RSV-A and -B clinical isolate strains Langedijk et al.38 N/A Equipment Thunder Imager 3D live Cell with Leica N/A Leica DFC9000 GCT camera Leica N/A Zeiss LSM800 confocal microscope Zeiss N/A Nanodrop spectrophotometer Thermo Fisher N/A CFX96 real-time detection machine Bio-Rad N/A BD FACSJazz BD Bioscience N/A Software and algorithms Leica LAS X Software Leica https://www.leicamicrosystems.com/ Zen Blue Software Zeiss https://www.zeiss.com/ ImageJ/FIJI NIH, Fiji developers https://imagej.net/Fiji/ GNU Image Manipulation Program https://www.gimp.org/ (Continued on next page) Cell Reports Medicine 7, 102692, April 21, 2026 e2 ..

    Article Title: ChIP ‐ MS in Plant Systems: Mapping the H3K27ac Proteome During the Greening Process
    Article Snippet: Extracted RNA was treated with DNase I (Thermo Scientific). .. Complementary DNA (cDNA) was synthesized using iScript cDNA Synthesis Kit (Bio‐Rad) following the manufacturer's instructions. qPCR reactions were performed using iQ SYBR Green Supermix (Bio‐Rad) on CFX96 or 384 Real‐Time System (Bio‐Rad). ..

    Polymerase Chain Reaction:

    Article Title: Differences in photosystem II activity and carbon allocation during photomixotrophic growth in distinct wild‐type strains of Synechocystis sp. PCC 6803
    Article Snippet: RNA was isolated using the TRIzol® Reagent (Invitrogen, Carlsbad, CA, USA), treated with TURBO DNA‐freeTM Kit (Invitrogen, Carlsbad, CA, USA), and purified with the chloroform:phenol:isoamyl alcohol method. cDNA was synthesized using the iScript cDNA Synthesis kit (Bio‐Rad, Hercules, CA, USA) with random primers. .. The qPCR reaction was carried out in 10 μL reactions composed of 5 μL of iQ SYBR® Green Supermix (Bio‐Rad), 2 μL dH 2 O, 2 μL diluted cDNA template (15 ng of RNA), and 0.5 μL mix of each 10 μ m forward and reverse PCR primer, utilizing the Bio‐Rad IQ5 system using rrn16Sa as a reference gene. ..

    Random Hexamer:

    Article Title: Live-cell single-vRNP imaging identifies viral gene expression signatures that shape influenza infection heterogeneity.
    Article Snippet: Article Live-cell single-vRNP imaging identifies viral gene expression signatures that shape influenza infection heterogeneity

    Membrane:

    Article Title: Live-cell single-vRNP imaging identifies viral gene expression signatures that shape influenza infection heterogeneity.
    Article Snippet: Article Live-cell single-vRNP imaging identifies viral gene expression signatures that shape influenza infection heterogeneity

    Article Title: Small molecule-directed differentiation of submerged-cultured human nasal airway epithelia for respiratory disease modeling.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-beta IV Tubulin antibody [EPR16776] Abcam Cat#ab179509; RRID: AB_2716759 Anti-Beta-Tubulin IV [ONS1A6] Emergo Biogenex Cat#MU178-UC; RRID: AB_2335625 MUC5AC Monoclonal Antibody (45M) Thermo Fisher Scientific Cat#MA1-38223; RRID: AB_2266697 Anti-p63 antibody [EPR5701] Abcam Cat#ab124762; RRID: AB_10971840 FOXJ1 Monoclonal Antibody (2A5) Thermo Fisher Scientific Cat#14-9965-80; RRID: AB_1548836 SLPI, Human, pAb Hycult Biotech Cat#HP9024; RRID: AB_2286624 Human pIgR Antibody R&D systems Cat#MAB27171; RRID: AB_3657978 Monoclonal Antibody to CC16 Origene Tech Cat#AM26360PU-N; RRID: AB_11216041 Anti-RSV Antibody, clone 133-1H Merck Cat#MAB8262; RRID: AB_95302 Anti-Rabbit IgG, Alexa Fluor 488 Thermo Fisher Scientific Cat#A-11034; RRID: AB_2576217 Anti-Mouse IgG1, Alexa Fluor 647 Thermo Fisher Scientific Cat#A-21240; RRID: AB_2535809 Chemicals and recombinant proteins DMEM Thermo Fisher Scientific Cat#12634-028 Opti-MEM Thermo Fisher Scientific Cat#31985062 BEpiCM-b Sciencell Cat#3211 advanced DMEM/F-12 Thermo Fisher Scientific Cat#12634-028 B-27 Supplement, serum free Thermo Fisher Scientific Cat#17504001 HEPES Thermo Fisher Scientific Cat#15630080 GlutaMAX Thermo Fisher Scientific Cat#35050-061 Hydrocortisone Sigma-Aldrich Cat#H0888 Epinephrine hydrochloride Sigma-Aldrich Cat#E4642 N-acetyl-L-cysteine Sigma-Aldrich Cat#A9165 Nicotinamide Sigma-Aldrich Cat#N0636 3,3′,5-Triiodo-L-thyronine sodium salt Sigma-Aldrich Cat#T6397 Penicillin/streptomycin Thermo Fisher Scientific Cat#15070-063 Primocin InvivoGen Cat#ant-pm-2 Amphotericin B Thermo Fisher Scientific Cat#15290018 Gentamicin Sigma-Aldrich Cat#G1397 Vancomycin Sigma-Aldrich Cat#SBR00001 A83-01 Tocris Cat#2939/10 Y-27632 Selleck Chemicals Cat#S1049 Rapamycin Sigma-Aldrich Cat#553210 DAPT Thermo Fisher Scientific Cat#15467109 DMH1 Selleck Chemicals Cat#S7146 TTNPB Cayman Cat#16144-1 RSPO3-Fc Fusion Protein CM U-Protein Express Cat#R001 Recombinant human Heregulin-β1 PeproTech Cat#100-03 Recombinant human FGF10 PeproTech Cat#100-26 Recombinant human HGF PeproTech Cat#100-39H Recombinant human EGF PeproTech Cat#AF-100-15 Recombinant human FGF7 PeproTech Cat#100-19 Recombinant Interleukin-1β PeproTech Cat#200-01 Nirsevimab Provided by AstraZeneca N/A (Continued on next page) e1 Cell Reports Medicine 7, 102692, April 21, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER Collagen IV Sigma-Aldrich Cat#C7521 PureCol Advanced BioMatrix Cat#5005 Cultrex Basement Membrane Extract, Type 2 Trevigen Cat#3532-010 TrypLE express enzyme Thermo Fisher Scientific Cat#12605010 CryoStor CS10 STEMCELL Technologies Cat#07930 SiR-tubulin Spirochrome AG Cat#SC002 DAPI Sigma-Aldrich Cat#D9542 ProLong Gold Thermo Fisher Scientific Cat#P36934 VX-809 Selleck Chemicals Cat#S1565 VX-661 Selleck Chemicals Cat#S7059 VX-445 MedChemExpress Cat#HY-11177 VX-770 Selleck Chemicals Cat#S1144 Calcein green (AM) Invitrogen Cat #C34852 Forskolin Sigma-Aldrich Cat#F3917 G418 (Geneticin) Invivogen Cat#GNL-40-03 ELX-02 (Exaluren) MedChemExpress Cat#HY-114231 Cultureware 96-well culture plates Greiner Bio-One Cat# 655182 24-well culture plates Greiner Bio-One Cat# 662160 12-well culture plates Greiner Bio-One Cat#665165 6-well culture plates Greiner Bio-One Cat#657160 6.5 mm Transwell with 0.4 μm Pore Polyester Membrane Insert Corning Cat#3470 Nunc dishes (35 mm) with UpCell Surface Thermo Fisher Scientific Cat#174904 Commercial kits RNeasy Mini Kit Qiagen Cat#74104 iScript cDNA synthesis kit Bio-Rad Cat#1708891 iQ SYBR Green Supermix Bio-Rad Cat1708880 Oligonucleotides qPCR Primers This papers, Table S4 N/A Experimental models: Primary cells and cell lines Human Nasal Epithelial Cells (HNEC) UMC Utrecht Protocol ID: 16–586, and 21-044 Human Epithelioma-2 (HEp-2) ATCC Cat#CCL-23 Experimental models: viral strains mKate-RSV-A2 Hotard et al.37 N/A RSV-A and -B clinical isolate strains Langedijk et al.38 N/A Equipment Thunder Imager 3D live Cell with Leica N/A Leica DFC9000 GCT camera Leica N/A Zeiss LSM800 confocal microscope Zeiss N/A Nanodrop spectrophotometer Thermo Fisher N/A CFX96 real-time detection machine Bio-Rad N/A BD FACSJazz BD Bioscience N/A Software and algorithms Leica LAS X Software Leica https://www.leicamicrosystems.com/ Zen Blue Software Zeiss https://www.zeiss.com/ ImageJ/FIJI NIH, Fiji developers https://imagej.net/Fiji/ GNU Image Manipulation Program https://www.gimp.org/ (Continued on next page) Cell Reports Medicine 7, 102692, April 21, 2026 e2 ..

    Recombinant:

    Article Title: Live-cell single-vRNP imaging identifies viral gene expression signatures that shape influenza infection heterogeneity.
    Article Snippet: Article Live-cell single-vRNP imaging identifies viral gene expression signatures that shape influenza infection heterogeneity

    Purification:

    Article Title: Live-cell single-vRNP imaging identifies viral gene expression signatures that shape influenza infection heterogeneity.
    Article Snippet: Article Live-cell single-vRNP imaging identifies viral gene expression signatures that shape influenza infection heterogeneity

    Imaging:

    Article Title: Live-cell single-vRNP imaging identifies viral gene expression signatures that shape influenza infection heterogeneity.
    Article Snippet: Article Live-cell single-vRNP imaging identifies viral gene expression signatures that shape influenza infection heterogeneity

    Gene Expression:

    Article Title: Auxin-Dependent Activation of RHD6-RSL4 Cascade Promotes Root Hair Growth Under Boron Deficiency in Arabidopsis Primary Root Apices.
    Article Snippet: Two micrograms of DNase‐treated total RNA were used to prepare cDNA by reverse transcription with M‐MLV reverse transcriptase (New England Biolabs Inc., Ipswich, MA, USA) and oligo (dT)18 primers (Bioline, London, UK), according to the manufacturer's protocol. .. Gene expression was determined by quantitative RT‐PCR (MyiQ real‐time PCR detection system, Bio‐Rad Laboratories Inc., Hercules, CA, USA) using gene‐ specific primers (Supporting Information Table S2) and iQ SYBR Green Supermix (Bio‐Rad), following the manufacturer's instructions. ..

    Synthesized:

    Article Title: Synergistic Impacts of Co-Exposure to Microplastics and Vibrio harveyi on the Immune and Stress Responses of the Big-Belly Seahorse Hippocampus abdominalis.
    Article Snippet: Microplastics (MPs) originating from synthetic polymers can act as vectors for harmful microorganisms and pollutants, exacerbating ecological risks.. Vibrio harveyi, commonly found in seawater, is a major opportunistic pathogen causing vibriosis in marine fish.. MPs and pathogenic bacteria such as V. harveyi have increasingly been recognized as co‐contaminants in marine environments.

    Article Title: ChIP ‐ MS in Plant Systems: Mapping the H3K27ac Proteome During the Greening Process
    Article Snippet: Extracted RNA was treated with DNase I (Thermo Scientific). .. Complementary DNA (cDNA) was synthesized using iScript cDNA Synthesis Kit (Bio‐Rad) following the manufacturer's instructions. qPCR reactions were performed using iQ SYBR Green Supermix (Bio‐Rad) on CFX96 or 384 Real‐Time System (Bio‐Rad). ..

    Expressing:

    Article Title: Synergistic Impacts of Co-Exposure to Microplastics and Vibrio harveyi on the Immune and Stress Responses of the Big-Belly Seahorse Hippocampus abdominalis.
    Article Snippet: Microplastics (MPs) originating from synthetic polymers can act as vectors for harmful microorganisms and pollutants, exacerbating ecological risks.. Vibrio harveyi, commonly found in seawater, is a major opportunistic pathogen causing vibriosis in marine fish.. MPs and pathogenic bacteria such as V. harveyi have increasingly been recognized as co‐contaminants in marine environments.

    cDNA Synthesis:

    Article Title: Small molecule-directed differentiation of submerged-cultured human nasal airway epithelia for respiratory disease modeling.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-beta IV Tubulin antibody [EPR16776] Abcam Cat#ab179509; RRID: AB_2716759 Anti-Beta-Tubulin IV [ONS1A6] Emergo Biogenex Cat#MU178-UC; RRID: AB_2335625 MUC5AC Monoclonal Antibody (45M) Thermo Fisher Scientific Cat#MA1-38223; RRID: AB_2266697 Anti-p63 antibody [EPR5701] Abcam Cat#ab124762; RRID: AB_10971840 FOXJ1 Monoclonal Antibody (2A5) Thermo Fisher Scientific Cat#14-9965-80; RRID: AB_1548836 SLPI, Human, pAb Hycult Biotech Cat#HP9024; RRID: AB_2286624 Human pIgR Antibody R&D systems Cat#MAB27171; RRID: AB_3657978 Monoclonal Antibody to CC16 Origene Tech Cat#AM26360PU-N; RRID: AB_11216041 Anti-RSV Antibody, clone 133-1H Merck Cat#MAB8262; RRID: AB_95302 Anti-Rabbit IgG, Alexa Fluor 488 Thermo Fisher Scientific Cat#A-11034; RRID: AB_2576217 Anti-Mouse IgG1, Alexa Fluor 647 Thermo Fisher Scientific Cat#A-21240; RRID: AB_2535809 Chemicals and recombinant proteins DMEM Thermo Fisher Scientific Cat#12634-028 Opti-MEM Thermo Fisher Scientific Cat#31985062 BEpiCM-b Sciencell Cat#3211 advanced DMEM/F-12 Thermo Fisher Scientific Cat#12634-028 B-27 Supplement, serum free Thermo Fisher Scientific Cat#17504001 HEPES Thermo Fisher Scientific Cat#15630080 GlutaMAX Thermo Fisher Scientific Cat#35050-061 Hydrocortisone Sigma-Aldrich Cat#H0888 Epinephrine hydrochloride Sigma-Aldrich Cat#E4642 N-acetyl-L-cysteine Sigma-Aldrich Cat#A9165 Nicotinamide Sigma-Aldrich Cat#N0636 3,3′,5-Triiodo-L-thyronine sodium salt Sigma-Aldrich Cat#T6397 Penicillin/streptomycin Thermo Fisher Scientific Cat#15070-063 Primocin InvivoGen Cat#ant-pm-2 Amphotericin B Thermo Fisher Scientific Cat#15290018 Gentamicin Sigma-Aldrich Cat#G1397 Vancomycin Sigma-Aldrich Cat#SBR00001 A83-01 Tocris Cat#2939/10 Y-27632 Selleck Chemicals Cat#S1049 Rapamycin Sigma-Aldrich Cat#553210 DAPT Thermo Fisher Scientific Cat#15467109 DMH1 Selleck Chemicals Cat#S7146 TTNPB Cayman Cat#16144-1 RSPO3-Fc Fusion Protein CM U-Protein Express Cat#R001 Recombinant human Heregulin-β1 PeproTech Cat#100-03 Recombinant human FGF10 PeproTech Cat#100-26 Recombinant human HGF PeproTech Cat#100-39H Recombinant human EGF PeproTech Cat#AF-100-15 Recombinant human FGF7 PeproTech Cat#100-19 Recombinant Interleukin-1β PeproTech Cat#200-01 Nirsevimab Provided by AstraZeneca N/A (Continued on next page) e1 Cell Reports Medicine 7, 102692, April 21, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER Collagen IV Sigma-Aldrich Cat#C7521 PureCol Advanced BioMatrix Cat#5005 Cultrex Basement Membrane Extract, Type 2 Trevigen Cat#3532-010 TrypLE express enzyme Thermo Fisher Scientific Cat#12605010 CryoStor CS10 STEMCELL Technologies Cat#07930 SiR-tubulin Spirochrome AG Cat#SC002 DAPI Sigma-Aldrich Cat#D9542 ProLong Gold Thermo Fisher Scientific Cat#P36934 VX-809 Selleck Chemicals Cat#S1565 VX-661 Selleck Chemicals Cat#S7059 VX-445 MedChemExpress Cat#HY-11177 VX-770 Selleck Chemicals Cat#S1144 Calcein green (AM) Invitrogen Cat #C34852 Forskolin Sigma-Aldrich Cat#F3917 G418 (Geneticin) Invivogen Cat#GNL-40-03 ELX-02 (Exaluren) MedChemExpress Cat#HY-114231 Cultureware 96-well culture plates Greiner Bio-One Cat# 655182 24-well culture plates Greiner Bio-One Cat# 662160 12-well culture plates Greiner Bio-One Cat#665165 6-well culture plates Greiner Bio-One Cat#657160 6.5 mm Transwell with 0.4 μm Pore Polyester Membrane Insert Corning Cat#3470 Nunc dishes (35 mm) with UpCell Surface Thermo Fisher Scientific Cat#174904 Commercial kits RNeasy Mini Kit Qiagen Cat#74104 iScript cDNA synthesis kit Bio-Rad Cat#1708891 iQ SYBR Green Supermix Bio-Rad Cat1708880 Oligonucleotides qPCR Primers This papers, Table S4 N/A Experimental models: Primary cells and cell lines Human Nasal Epithelial Cells (HNEC) UMC Utrecht Protocol ID: 16–586, and 21-044 Human Epithelioma-2 (HEp-2) ATCC Cat#CCL-23 Experimental models: viral strains mKate-RSV-A2 Hotard et al.37 N/A RSV-A and -B clinical isolate strains Langedijk et al.38 N/A Equipment Thunder Imager 3D live Cell with Leica N/A Leica DFC9000 GCT camera Leica N/A Zeiss LSM800 confocal microscope Zeiss N/A Nanodrop spectrophotometer Thermo Fisher N/A CFX96 real-time detection machine Bio-Rad N/A BD FACSJazz BD Bioscience N/A Software and algorithms Leica LAS X Software Leica https://www.leicamicrosystems.com/ Zen Blue Software Zeiss https://www.zeiss.com/ ImageJ/FIJI NIH, Fiji developers https://imagej.net/Fiji/ GNU Image Manipulation Program https://www.gimp.org/ (Continued on next page) Cell Reports Medicine 7, 102692, April 21, 2026 e2 ..

    Article Title: ChIP ‐ MS in Plant Systems: Mapping the H3K27ac Proteome During the Greening Process
    Article Snippet: Extracted RNA was treated with DNase I (Thermo Scientific). .. Complementary DNA (cDNA) was synthesized using iScript cDNA Synthesis Kit (Bio‐Rad) following the manufacturer's instructions. qPCR reactions were performed using iQ SYBR Green Supermix (Bio‐Rad) on CFX96 or 384 Real‐Time System (Bio‐Rad). ..

    Microscopy:

    Article Title: Small molecule-directed differentiation of submerged-cultured human nasal airway epithelia for respiratory disease modeling.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-beta IV Tubulin antibody [EPR16776] Abcam Cat#ab179509; RRID: AB_2716759 Anti-Beta-Tubulin IV [ONS1A6] Emergo Biogenex Cat#MU178-UC; RRID: AB_2335625 MUC5AC Monoclonal Antibody (45M) Thermo Fisher Scientific Cat#MA1-38223; RRID: AB_2266697 Anti-p63 antibody [EPR5701] Abcam Cat#ab124762; RRID: AB_10971840 FOXJ1 Monoclonal Antibody (2A5) Thermo Fisher Scientific Cat#14-9965-80; RRID: AB_1548836 SLPI, Human, pAb Hycult Biotech Cat#HP9024; RRID: AB_2286624 Human pIgR Antibody R&D systems Cat#MAB27171; RRID: AB_3657978 Monoclonal Antibody to CC16 Origene Tech Cat#AM26360PU-N; RRID: AB_11216041 Anti-RSV Antibody, clone 133-1H Merck Cat#MAB8262; RRID: AB_95302 Anti-Rabbit IgG, Alexa Fluor 488 Thermo Fisher Scientific Cat#A-11034; RRID: AB_2576217 Anti-Mouse IgG1, Alexa Fluor 647 Thermo Fisher Scientific Cat#A-21240; RRID: AB_2535809 Chemicals and recombinant proteins DMEM Thermo Fisher Scientific Cat#12634-028 Opti-MEM Thermo Fisher Scientific Cat#31985062 BEpiCM-b Sciencell Cat#3211 advanced DMEM/F-12 Thermo Fisher Scientific Cat#12634-028 B-27 Supplement, serum free Thermo Fisher Scientific Cat#17504001 HEPES Thermo Fisher Scientific Cat#15630080 GlutaMAX Thermo Fisher Scientific Cat#35050-061 Hydrocortisone Sigma-Aldrich Cat#H0888 Epinephrine hydrochloride Sigma-Aldrich Cat#E4642 N-acetyl-L-cysteine Sigma-Aldrich Cat#A9165 Nicotinamide Sigma-Aldrich Cat#N0636 3,3′,5-Triiodo-L-thyronine sodium salt Sigma-Aldrich Cat#T6397 Penicillin/streptomycin Thermo Fisher Scientific Cat#15070-063 Primocin InvivoGen Cat#ant-pm-2 Amphotericin B Thermo Fisher Scientific Cat#15290018 Gentamicin Sigma-Aldrich Cat#G1397 Vancomycin Sigma-Aldrich Cat#SBR00001 A83-01 Tocris Cat#2939/10 Y-27632 Selleck Chemicals Cat#S1049 Rapamycin Sigma-Aldrich Cat#553210 DAPT Thermo Fisher Scientific Cat#15467109 DMH1 Selleck Chemicals Cat#S7146 TTNPB Cayman Cat#16144-1 RSPO3-Fc Fusion Protein CM U-Protein Express Cat#R001 Recombinant human Heregulin-β1 PeproTech Cat#100-03 Recombinant human FGF10 PeproTech Cat#100-26 Recombinant human HGF PeproTech Cat#100-39H Recombinant human EGF PeproTech Cat#AF-100-15 Recombinant human FGF7 PeproTech Cat#100-19 Recombinant Interleukin-1β PeproTech Cat#200-01 Nirsevimab Provided by AstraZeneca N/A (Continued on next page) e1 Cell Reports Medicine 7, 102692, April 21, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER Collagen IV Sigma-Aldrich Cat#C7521 PureCol Advanced BioMatrix Cat#5005 Cultrex Basement Membrane Extract, Type 2 Trevigen Cat#3532-010 TrypLE express enzyme Thermo Fisher Scientific Cat#12605010 CryoStor CS10 STEMCELL Technologies Cat#07930 SiR-tubulin Spirochrome AG Cat#SC002 DAPI Sigma-Aldrich Cat#D9542 ProLong Gold Thermo Fisher Scientific Cat#P36934 VX-809 Selleck Chemicals Cat#S1565 VX-661 Selleck Chemicals Cat#S7059 VX-445 MedChemExpress Cat#HY-11177 VX-770 Selleck Chemicals Cat#S1144 Calcein green (AM) Invitrogen Cat #C34852 Forskolin Sigma-Aldrich Cat#F3917 G418 (Geneticin) Invivogen Cat#GNL-40-03 ELX-02 (Exaluren) MedChemExpress Cat#HY-114231 Cultureware 96-well culture plates Greiner Bio-One Cat# 655182 24-well culture plates Greiner Bio-One Cat# 662160 12-well culture plates Greiner Bio-One Cat#665165 6-well culture plates Greiner Bio-One Cat#657160 6.5 mm Transwell with 0.4 μm Pore Polyester Membrane Insert Corning Cat#3470 Nunc dishes (35 mm) with UpCell Surface Thermo Fisher Scientific Cat#174904 Commercial kits RNeasy Mini Kit Qiagen Cat#74104 iScript cDNA synthesis kit Bio-Rad Cat#1708891 iQ SYBR Green Supermix Bio-Rad Cat1708880 Oligonucleotides qPCR Primers This papers, Table S4 N/A Experimental models: Primary cells and cell lines Human Nasal Epithelial Cells (HNEC) UMC Utrecht Protocol ID: 16–586, and 21-044 Human Epithelioma-2 (HEp-2) ATCC Cat#CCL-23 Experimental models: viral strains mKate-RSV-A2 Hotard et al.37 N/A RSV-A and -B clinical isolate strains Langedijk et al.38 N/A Equipment Thunder Imager 3D live Cell with Leica N/A Leica DFC9000 GCT camera Leica N/A Zeiss LSM800 confocal microscope Zeiss N/A Nanodrop spectrophotometer Thermo Fisher N/A CFX96 real-time detection machine Bio-Rad N/A BD FACSJazz BD Bioscience N/A Software and algorithms Leica LAS X Software Leica https://www.leicamicrosystems.com/ Zen Blue Software Zeiss https://www.zeiss.com/ ImageJ/FIJI NIH, Fiji developers https://imagej.net/Fiji/ GNU Image Manipulation Program https://www.gimp.org/ (Continued on next page) Cell Reports Medicine 7, 102692, April 21, 2026 e2 ..

    Spectrophotometry:

    Article Title: Small molecule-directed differentiation of submerged-cultured human nasal airway epithelia for respiratory disease modeling.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-beta IV Tubulin antibody [EPR16776] Abcam Cat#ab179509; RRID: AB_2716759 Anti-Beta-Tubulin IV [ONS1A6] Emergo Biogenex Cat#MU178-UC; RRID: AB_2335625 MUC5AC Monoclonal Antibody (45M) Thermo Fisher Scientific Cat#MA1-38223; RRID: AB_2266697 Anti-p63 antibody [EPR5701] Abcam Cat#ab124762; RRID: AB_10971840 FOXJ1 Monoclonal Antibody (2A5) Thermo Fisher Scientific Cat#14-9965-80; RRID: AB_1548836 SLPI, Human, pAb Hycult Biotech Cat#HP9024; RRID: AB_2286624 Human pIgR Antibody R&D systems Cat#MAB27171; RRID: AB_3657978 Monoclonal Antibody to CC16 Origene Tech Cat#AM26360PU-N; RRID: AB_11216041 Anti-RSV Antibody, clone 133-1H Merck Cat#MAB8262; RRID: AB_95302 Anti-Rabbit IgG, Alexa Fluor 488 Thermo Fisher Scientific Cat#A-11034; RRID: AB_2576217 Anti-Mouse IgG1, Alexa Fluor 647 Thermo Fisher Scientific Cat#A-21240; RRID: AB_2535809 Chemicals and recombinant proteins DMEM Thermo Fisher Scientific Cat#12634-028 Opti-MEM Thermo Fisher Scientific Cat#31985062 BEpiCM-b Sciencell Cat#3211 advanced DMEM/F-12 Thermo Fisher Scientific Cat#12634-028 B-27 Supplement, serum free Thermo Fisher Scientific Cat#17504001 HEPES Thermo Fisher Scientific Cat#15630080 GlutaMAX Thermo Fisher Scientific Cat#35050-061 Hydrocortisone Sigma-Aldrich Cat#H0888 Epinephrine hydrochloride Sigma-Aldrich Cat#E4642 N-acetyl-L-cysteine Sigma-Aldrich Cat#A9165 Nicotinamide Sigma-Aldrich Cat#N0636 3,3′,5-Triiodo-L-thyronine sodium salt Sigma-Aldrich Cat#T6397 Penicillin/streptomycin Thermo Fisher Scientific Cat#15070-063 Primocin InvivoGen Cat#ant-pm-2 Amphotericin B Thermo Fisher Scientific Cat#15290018 Gentamicin Sigma-Aldrich Cat#G1397 Vancomycin Sigma-Aldrich Cat#SBR00001 A83-01 Tocris Cat#2939/10 Y-27632 Selleck Chemicals Cat#S1049 Rapamycin Sigma-Aldrich Cat#553210 DAPT Thermo Fisher Scientific Cat#15467109 DMH1 Selleck Chemicals Cat#S7146 TTNPB Cayman Cat#16144-1 RSPO3-Fc Fusion Protein CM U-Protein Express Cat#R001 Recombinant human Heregulin-β1 PeproTech Cat#100-03 Recombinant human FGF10 PeproTech Cat#100-26 Recombinant human HGF PeproTech Cat#100-39H Recombinant human EGF PeproTech Cat#AF-100-15 Recombinant human FGF7 PeproTech Cat#100-19 Recombinant Interleukin-1β PeproTech Cat#200-01 Nirsevimab Provided by AstraZeneca N/A (Continued on next page) e1 Cell Reports Medicine 7, 102692, April 21, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER Collagen IV Sigma-Aldrich Cat#C7521 PureCol Advanced BioMatrix Cat#5005 Cultrex Basement Membrane Extract, Type 2 Trevigen Cat#3532-010 TrypLE express enzyme Thermo Fisher Scientific Cat#12605010 CryoStor CS10 STEMCELL Technologies Cat#07930 SiR-tubulin Spirochrome AG Cat#SC002 DAPI Sigma-Aldrich Cat#D9542 ProLong Gold Thermo Fisher Scientific Cat#P36934 VX-809 Selleck Chemicals Cat#S1565 VX-661 Selleck Chemicals Cat#S7059 VX-445 MedChemExpress Cat#HY-11177 VX-770 Selleck Chemicals Cat#S1144 Calcein green (AM) Invitrogen Cat #C34852 Forskolin Sigma-Aldrich Cat#F3917 G418 (Geneticin) Invivogen Cat#GNL-40-03 ELX-02 (Exaluren) MedChemExpress Cat#HY-114231 Cultureware 96-well culture plates Greiner Bio-One Cat# 655182 24-well culture plates Greiner Bio-One Cat# 662160 12-well culture plates Greiner Bio-One Cat#665165 6-well culture plates Greiner Bio-One Cat#657160 6.5 mm Transwell with 0.4 μm Pore Polyester Membrane Insert Corning Cat#3470 Nunc dishes (35 mm) with UpCell Surface Thermo Fisher Scientific Cat#174904 Commercial kits RNeasy Mini Kit Qiagen Cat#74104 iScript cDNA synthesis kit Bio-Rad Cat#1708891 iQ SYBR Green Supermix Bio-Rad Cat1708880 Oligonucleotides qPCR Primers This papers, Table S4 N/A Experimental models: Primary cells and cell lines Human Nasal Epithelial Cells (HNEC) UMC Utrecht Protocol ID: 16–586, and 21-044 Human Epithelioma-2 (HEp-2) ATCC Cat#CCL-23 Experimental models: viral strains mKate-RSV-A2 Hotard et al.37 N/A RSV-A and -B clinical isolate strains Langedijk et al.38 N/A Equipment Thunder Imager 3D live Cell with Leica N/A Leica DFC9000 GCT camera Leica N/A Zeiss LSM800 confocal microscope Zeiss N/A Nanodrop spectrophotometer Thermo Fisher N/A CFX96 real-time detection machine Bio-Rad N/A BD FACSJazz BD Bioscience N/A Software and algorithms Leica LAS X Software Leica https://www.leicamicrosystems.com/ Zen Blue Software Zeiss https://www.zeiss.com/ ImageJ/FIJI NIH, Fiji developers https://imagej.net/Fiji/ GNU Image Manipulation Program https://www.gimp.org/ (Continued on next page) Cell Reports Medicine 7, 102692, April 21, 2026 e2 ..

    Software:

    Article Title: Small molecule-directed differentiation of submerged-cultured human nasal airway epithelia for respiratory disease modeling.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-beta IV Tubulin antibody [EPR16776] Abcam Cat#ab179509; RRID: AB_2716759 Anti-Beta-Tubulin IV [ONS1A6] Emergo Biogenex Cat#MU178-UC; RRID: AB_2335625 MUC5AC Monoclonal Antibody (45M) Thermo Fisher Scientific Cat#MA1-38223; RRID: AB_2266697 Anti-p63 antibody [EPR5701] Abcam Cat#ab124762; RRID: AB_10971840 FOXJ1 Monoclonal Antibody (2A5) Thermo Fisher Scientific Cat#14-9965-80; RRID: AB_1548836 SLPI, Human, pAb Hycult Biotech Cat#HP9024; RRID: AB_2286624 Human pIgR Antibody R&D systems Cat#MAB27171; RRID: AB_3657978 Monoclonal Antibody to CC16 Origene Tech Cat#AM26360PU-N; RRID: AB_11216041 Anti-RSV Antibody, clone 133-1H Merck Cat#MAB8262; RRID: AB_95302 Anti-Rabbit IgG, Alexa Fluor 488 Thermo Fisher Scientific Cat#A-11034; RRID: AB_2576217 Anti-Mouse IgG1, Alexa Fluor 647 Thermo Fisher Scientific Cat#A-21240; RRID: AB_2535809 Chemicals and recombinant proteins DMEM Thermo Fisher Scientific Cat#12634-028 Opti-MEM Thermo Fisher Scientific Cat#31985062 BEpiCM-b Sciencell Cat#3211 advanced DMEM/F-12 Thermo Fisher Scientific Cat#12634-028 B-27 Supplement, serum free Thermo Fisher Scientific Cat#17504001 HEPES Thermo Fisher Scientific Cat#15630080 GlutaMAX Thermo Fisher Scientific Cat#35050-061 Hydrocortisone Sigma-Aldrich Cat#H0888 Epinephrine hydrochloride Sigma-Aldrich Cat#E4642 N-acetyl-L-cysteine Sigma-Aldrich Cat#A9165 Nicotinamide Sigma-Aldrich Cat#N0636 3,3′,5-Triiodo-L-thyronine sodium salt Sigma-Aldrich Cat#T6397 Penicillin/streptomycin Thermo Fisher Scientific Cat#15070-063 Primocin InvivoGen Cat#ant-pm-2 Amphotericin B Thermo Fisher Scientific Cat#15290018 Gentamicin Sigma-Aldrich Cat#G1397 Vancomycin Sigma-Aldrich Cat#SBR00001 A83-01 Tocris Cat#2939/10 Y-27632 Selleck Chemicals Cat#S1049 Rapamycin Sigma-Aldrich Cat#553210 DAPT Thermo Fisher Scientific Cat#15467109 DMH1 Selleck Chemicals Cat#S7146 TTNPB Cayman Cat#16144-1 RSPO3-Fc Fusion Protein CM U-Protein Express Cat#R001 Recombinant human Heregulin-β1 PeproTech Cat#100-03 Recombinant human FGF10 PeproTech Cat#100-26 Recombinant human HGF PeproTech Cat#100-39H Recombinant human EGF PeproTech Cat#AF-100-15 Recombinant human FGF7 PeproTech Cat#100-19 Recombinant Interleukin-1β PeproTech Cat#200-01 Nirsevimab Provided by AstraZeneca N/A (Continued on next page) e1 Cell Reports Medicine 7, 102692, April 21, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER Collagen IV Sigma-Aldrich Cat#C7521 PureCol Advanced BioMatrix Cat#5005 Cultrex Basement Membrane Extract, Type 2 Trevigen Cat#3532-010 TrypLE express enzyme Thermo Fisher Scientific Cat#12605010 CryoStor CS10 STEMCELL Technologies Cat#07930 SiR-tubulin Spirochrome AG Cat#SC002 DAPI Sigma-Aldrich Cat#D9542 ProLong Gold Thermo Fisher Scientific Cat#P36934 VX-809 Selleck Chemicals Cat#S1565 VX-661 Selleck Chemicals Cat#S7059 VX-445 MedChemExpress Cat#HY-11177 VX-770 Selleck Chemicals Cat#S1144 Calcein green (AM) Invitrogen Cat #C34852 Forskolin Sigma-Aldrich Cat#F3917 G418 (Geneticin) Invivogen Cat#GNL-40-03 ELX-02 (Exaluren) MedChemExpress Cat#HY-114231 Cultureware 96-well culture plates Greiner Bio-One Cat# 655182 24-well culture plates Greiner Bio-One Cat# 662160 12-well culture plates Greiner Bio-One Cat#665165 6-well culture plates Greiner Bio-One Cat#657160 6.5 mm Transwell with 0.4 μm Pore Polyester Membrane Insert Corning Cat#3470 Nunc dishes (35 mm) with UpCell Surface Thermo Fisher Scientific Cat#174904 Commercial kits RNeasy Mini Kit Qiagen Cat#74104 iScript cDNA synthesis kit Bio-Rad Cat#1708891 iQ SYBR Green Supermix Bio-Rad Cat1708880 Oligonucleotides qPCR Primers This papers, Table S4 N/A Experimental models: Primary cells and cell lines Human Nasal Epithelial Cells (HNEC) UMC Utrecht Protocol ID: 16–586, and 21-044 Human Epithelioma-2 (HEp-2) ATCC Cat#CCL-23 Experimental models: viral strains mKate-RSV-A2 Hotard et al.37 N/A RSV-A and -B clinical isolate strains Langedijk et al.38 N/A Equipment Thunder Imager 3D live Cell with Leica N/A Leica DFC9000 GCT camera Leica N/A Zeiss LSM800 confocal microscope Zeiss N/A Nanodrop spectrophotometer Thermo Fisher N/A CFX96 real-time detection machine Bio-Rad N/A BD FACSJazz BD Bioscience N/A Software and algorithms Leica LAS X Software Leica https://www.leicamicrosystems.com/ Zen Blue Software Zeiss https://www.zeiss.com/ ImageJ/FIJI NIH, Fiji developers https://imagej.net/Fiji/ GNU Image Manipulation Program https://www.gimp.org/ (Continued on next page) Cell Reports Medicine 7, 102692, April 21, 2026 e2 ..



    Similar Products

    98
    Bio-Rad bio rad iq sybr green supermix
    Bio Rad Iq Sybr Green Supermix, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/iq+sybr+green+supermix+bio+rad/iQ+SYBR+Green+Supermix/pm42121932-93-18-18
    Average 98 stars, based on 1 article reviews
    bio rad iq sybr green supermix - by Bioz Stars, 2026-09
    98/100 stars
      Buy from Supplier

    98
    Bio-Rad iq sybr green supermix bio rad
    Iq Sybr Green Supermix Bio Rad, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/iq+sybr+green+supermix+bio+rad/iQ+SYBR+Green+Supermix/pm42108604-58-27-31
    Average 98 stars, based on 1 article reviews
    iq sybr green supermix bio rad - by Bioz Stars, 2026-09
    98/100 stars
      Buy from Supplier

    98
    Bio-Rad bio rad iq sybr green supermix kit
    Bio Rad Iq Sybr Green Supermix Kit, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/iq+sybr+green+supermix+bio+rad/iQ+SYBR+Green+Supermix/pm42072354-122-34-34
    Average 98 stars, based on 1 article reviews
    bio rad iq sybr green supermix kit - by Bioz Stars, 2026-09
    98/100 stars
      Buy from Supplier

    98
    Bio-Rad iq syber green supermix bio rad
    Iq Syber Green Supermix Bio Rad, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/iq+sybr+green+supermix+bio+rad/iQ+SYBR+Green+Supermix/pmc13112331-50-11-15
    Average 98 stars, based on 1 article reviews
    iq syber green supermix bio rad - by Bioz Stars, 2026-09
    98/100 stars
      Buy from Supplier

    98
    Bio-Rad sybr green supermix bio rad
    Sybr Green Supermix Bio Rad, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/iq+sybr+green+supermix+bio+rad/iQ+SYBR+Green+Supermix/pmc13092339-88-8-11
    Average 98 stars, based on 1 article reviews
    sybr green supermix bio rad - by Bioz Stars, 2026-09
    98/100 stars
      Buy from Supplier

    98
    Bio-Rad bio rad sybr green supermix
    Bio Rad Sybr Green Supermix, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/iq+sybr+green+supermix+bio+rad/iQ+SYBR+Green+Supermix/pm41997664-73-68-68
    Average 98 stars, based on 1 article reviews
    bio rad sybr green supermix - by Bioz Stars, 2026-09
    98/100 stars
      Buy from Supplier

    98
    Bio-Rad iq sybr green supermix bio rad cat
    Iq Sybr Green Supermix Bio Rad Cat, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/iq+sybr+green+supermix+bio+rad/iQ+SYBR+Green+Supermix/pm41933972-266-104-108
    Average 98 stars, based on 1 article reviews
    iq sybr green supermix bio rad cat - by Bioz Stars, 2026-09
    98/100 stars
      Buy from Supplier

    Image Search Results